Human Fibrinogen (FBG) ELISA Kit

$407.00

Catalog Number: EF2040-1

This assay employs a quantitative enzyme immunoassay technique that measures the specified antigen in samples.
Product Size:96 Well Plate

Additional information

Format

Sandwich ELISA

Entrez Gene

2243, 2244, 2266

Components

Biotinylated Human Fibrinogen Antibody, Chromogen Substrate (1x), Human Fibrinogen Microplate, Human Fibrinogen Standard, MIX Diluent Concentrate (10x), Sealing Tapes, SP Conjugate (100x), Stop Solution (1x), Wash Buffer Concentrate (20x)

TIme

4 hours

Sensitivity

0.81 ng/ml

Range

1.25 – 80 ng/ml

Samples Type

CSF, Milk, Plasma, Saliva, Urine

Associated Disease

Blood Disorder, Cardiac

Species

Human

UniProt

P02671, P02675, P02679

Storage

Refer to component labels for details

Plex

1

Usage

For Research Use Only, Not To Be Used For Diagnostic Purposes

Documentation

Publications citing Assaypro: Human Fibrinogen (FBG) ELISA Kit... (47 results)

Please use discretion when following external links; Assaypro cannot guarantee the validity and security of all citation links provided.

Association of nuts and whole grains intake, inflammation and the metabolic syndrome

  • http://arnmsmb.com/old/rjmms/rjmms/2013/55-63.pdf
  • SM El Shebini, MIA Moaty, NH Ahmed...- Res. J. Med. Med..., 2015 - arnmsmb.com
  • Background: Metabolic syndrome (MetS) is considered a proinflamatory and prothrombotic state. The measurement of inflammatory and prothrombotic markers might improve the...

Evaluating the effect of antidiabetic treatment on haemostatic and fibrinolytic parameters among type 2 diabetics in Ilorin, Nigeria

Th1-CD11c+ B Cell Axis Associated with Response to Plasmapheresis in Multiple Sclerosis

Association of Serum Fibrinogen and Plasma VEGF Levels with Tumor Characteristics and Treatment Response in Operable Breast Carcinoma.

In vitro blood compatibility evaluation method: incubating while rotating hemodialyzers filled with fresh human blood

Coagulation failure is associated with bleeding events and clinical outcome during systemic inflammatory response and sepsis in acute on chronic liver failure: An observational cohort study

Multi-targeted therapy of hepatic fibrosis by adipose tissue derived mesenchymal stem cells

Pleural effusion and plasma levels of fibrinolytic parameters in tuberculosis pleurisy and contribution to the diagnosis

Plasma Clusterin Concentrations May Predict Resistance to Intravenous Immunoglobulin in Patients with Kawasaki Disease

Assessment of some plasma fibrinolytic proteins in sickle cell anemia patients in steady state and in vaso-occlusive crises

Amino acid-mediated heterotypic interaction governs performance of a hepatic tissue model

Concentrated Plasma as a Carrier for Stem Cell Delivery

Methods of making concentrated fibrinogen containing compositions and associated systems for preparing fibrin glue

Technique for the control of spheroid diameter using microfabricated chips

Acute Traumatic Coagulopathy: Initiated by Hypoperfusion: Modulated Through the Protein C Pathway?

Autologous fibrinogen purification and concentration for use in fibrin sealant

Th1 - CD11c + B Cell Axis Associated with Response to Plasmapheresis in Multiple Sclerosis.

  • https://pubmed.ncbi.nlm.nih.gov/34424567/
  • Kimitoshi Kimura, Youwei Lin, ..., Takashi Yamamura (2021). Annals of Neurology. 2021 Dec 13
  • .. (FP:ACTGCCAGGACCCATATGTAA, RP:GTTCCATTATCCGCTACATCTGAA), STAT1 (FP:ATGCTGGCACCAGAACGAA, RP:GCTGGCACAATTGGGTTTCAA), STAT4 (FP:CAGTGCTGGAGGTAAAGGAA, RP:AGAGGCAGATCTGTGTTTCAA), TBX21 (FP:GGGCGTCCAACAATGTGAC, RP:CCGTCGTTCACCTCAACGATA) (Fasmac, Atsugi, Japan).. Detection of fibrinogen, immunoglobulin, and other cytokines The concentration of fibrinogen in the plasma was determined with AssayMax Human Fibrinogen ELISA Kit (Assaypro, MO, USA).. The concentration of immunoglobulin in the serum was determined using Antibody Isotyping 7-Plex Human ..

Acquired hypofibrinogenemia in a patient with multiple myeloma.

  • https://pubmed.ncbi.nlm.nih.gov/34057670/
  • Shojiro Inano, Yuki Oku, ..., Toshiyuki Kitano (2021). International journal of hematology. 2021 Aug 31
  • In this study, the Human Fibrinogen FBG AssayMax ELISA Kit from Assaypro played a crucial role in measuring immunological fibrinogen levels, which was key to confirming the diagnosis o…

Heparin-like Effect Associated With Risk of Bleeding, Sepsis, and Death in Patients With Severe Alcohol-Associated Hepatitis.

  • https://pubmed.ncbi.nlm.nih.gov/31077821/
  • Madhumita Premkumar, Chhagan Bihari, ..., Shiv Kumar Sarin (2021). Clinical gastroenterology and hepatology :…. 2021 Aug 18
  • In the study investigating severe alcohol-associated hepatitis, the Human Fibrinogen FBG AssayMax ELISA Kit from Assaypro played a crucial role in quantifying fibrinogen levels. This m…

Analysis of the levels of inflammatory parameters in persons over the age of 90

  • https://pubmed.ncbi.nlm.nih.gov/33592278/
  • Paulina Zabielska, Sylwia Wieder-Huszla, ..., Anna Jurczak (2021). Experimental Gerontology. 2021 Jun 01
  • nzymatic assays using commercially available enzyme-linked immunosorbent assay (ELISA) kits, according to the manufacturer’s protocol: DRG, Germany, for IL-1α,IL-1ß,IL-6, TNF α, CRP, IL-10, TGF-β1and Assaypro, USA, for fibrinogen. All patients were thoroughly informed about the scope and objectives of the study and gave their written consent for participation. The study was approved by the Bioethic

Activated factor X targeted stored in platelets as an effective gene therapy strategy for both hemophilia A and B

  • https://pubmed.ncbi.nlm.nih.gov/33783994/
  • Dawei Wang, Xiaohu Shao, ..., Guowei Zhang (2021). Clinical and Translational Medicine. 2021 Mar 24
  • and D‐Dimer measurement. To avoid TF contamination, the first drop of blood was discarded. Commercially available kits were used to determine levels of TAT (Abcam, Cambridge, MA, USA) and fibrinogen (Assaypro, Charles, MO, USA) according to the manufacturer's guidance. D‐dimer levels were detected using a mouse D‐Dimer ELISA kit (Westang, Shanghai, China). Briefly, a 96‐well plate was pre‐coated wi

The Effectiveness of 3 Combined Therapeutic Regimens in Egyptian Patients with Moderate-to-Severe Chronic Obstructive Pulmonary Disease: A Randomized Double-Blind Prospective Pilot Study

  • https://pubmed.ncbi.nlm.nih.gov/34306265/
  • Tarek M Mostafa, Gamal A El-Azab, ..., Noran S Lotfy (2021). Current Therapeutic Research, Clinical and…. 2021 Mar 08
  • atment. Plasma was separated and immediately stored at –80°C until biochemical analyses of plasma TNF-α, plasma fibrinogen, and plasma IL-6 concentrations using the commercially available ELISA kits (Assaypro; LLC Biotechnology Company, Saint Charles, Missouri) using a Tecan plate reader infinite F 50 (Tecan Group Ltd, Mannedorf, Switzerland). For assessment of inflammatory markers' concentrations,

In vitro blood compatibility evaluation method: incubating while rotating hemodialyzers filled with fresh human blood

  • https://pubmed.ncbi.nlm.nih.gov/33200301/
  • Kinue Kamata, Yoshihiro Hatanaka, ..., Toshinori Koizumi (2020). Journal of Artificial Organs. 2020 Nov 16
  • .. with 0.5% Triton-X/phosphate-buffered saline (−) at 1300 rpm for 1 h at room temperature.. The competitive enzyme-linked immunosorbent assay method (Fibrinogen, Human, ELISA Kit, Assay Max, EF1040-1, Assay Pro LLC.) was used to measure the amount of fibrinogen adsorbed to the hemodialysis membranes.

Coagulation failure is associated with bleeding events and clinical outcome during systemic inflammatory response and sepsis in acute-on-chronic liver failure: An observational cohort study.

  • https://pubmed.ncbi.nlm.nih.gov/30589495/
  • Madhumita Premkumar, Priyanka Saxena, ..., Shiv K Sarin (2020). Liver international : official journal of …. 2020 May 12
  • In this observational cohort study, the Human Fibrinogen FBG AssayMax ELISA Kit from Assaypro played a significant role in quantifying fibrinogen levels in patients with acute-on-chron…

Analysis of the safety and pharmacodynamics of human fibrinogen concentrate in animals

  • https://pubmed.ncbi.nlm.nih.gov/25102310/
  • Andrea Beyerle, Marc W Nolte, ..., Gerhard Dickneite (2014). Toxicology and Applied Pharmacology. 2014 Oct 01
  • asma was separated immediately. Each plasma sample was used to quantify human fibrinogen antigen concentration using a validated ELISA technique according to the manufacturer's instructions (Study 2: AssayPro LLC, St. Charles,MO; Study 3: Cedarlane Laboratories Ltd., Burlington, NC). The following pharmacokinetic variables of fibrinogen were determined: maximum concentration (Cmax), in vivo recover

Transferrin-bound proteins as potential biomarkers for advanced breast cancer patients

  • https://pubmed.ncbi.nlm.nih.gov/26673961/
  • Paul Dowling, Valentina Palmerini, ..., Martin Clynes (2014). BBA Clinical. 2014 Sep 16
  • ELISA kits for Fibrinogen (EF1040-1) and for Fibronectin (EF1045-1) from Assaypro were used as per manufacturer's instructions (AssayPro, Winfield, MO, USA).. CA15-3 was assayed using an ELISA kit from Abcam (ab108633, Abcam UK).CA15-3 was assayed ..

Effects of Pristane Alone or Combined with Chloroquine on Macrophage Activation, Oxidative Stress, and Th1/Th2 Skewness

  • https://pubmed.ncbi.nlm.nih.gov/25136646/
  • Qiufang Ouyang, Ziyang Huang, ..., Ling Lin (2014). Journal of immunology research. 2014 Jan 01
  • in-4 (IL-4), and IL-6 in serum according to the instructions (all from eBioscience, San Diego, CA, USA), and so were IgG1 and IgG2a (all from Alpha Diagnostic). The levels of ferritin and fibrinogen (Assaypro, Missouri) were assayed by ELISA method. All the measurements were carried out in duplicate. The levels of lactate dehydrogenase (LDH) and triglyceride in plasma were assayed with an automatic

Plasma Clusterin Concentrations May Predict Resistance to Intravenous Immunoglobulin in Patients with Kawasaki Disease

  • https://pubmed.ncbi.nlm.nih.gov/23956692/
  • Mei-Chen Ou-Yang, Ho-Chang Kuo, ..., Hong-Ren Yu (2013). The Scientific World Journal. 2013 Jan 01
  • Abstract: Kawasaki disease (KD) is an acute febrile vasculitic syndrome of early childhood often complicated by coronary artery lesion that drastically reduces the quality of life. The study aimed to …

Rosiglitazone and AS601245 Decrease Cell Adhesion and Migration through Modulation of Specific Gene Expression in Human Colon Cancer Cells

  • https://pubmed.ncbi.nlm.nih.gov/22761953/
  • Angelo Cerbone, Cristina Toaldo, ..., Frederic Andre (2012). PLoS ONE. 2012 Jun 28
  • Fibrinogen (FBG) release in culture media was analysed by using the AssayMax Human Fibrinogen (FBG) ELISE Kit from Assaypro (St. Charles, MO, USA) according to the manufacturer’s protocol.. CaCo-2 cells were grown in flasks and seeded at the concentration of 4 x ..

Haemostatic effects of simvastatin in subjects with impaired glucose tolerance

  • https://pubmed.ncbi.nlm.nih.gov/21118403/
  • R Krysiak, B Okopien (2011). Internal medicine journal. 2011 Jun 01
  • Abstract: Very little is known about extra-lipid effects of statins in prediabetic subjects. Our study has assessed the effect of simvastatin on coagulation and fibrinolysis in patients with impaired …

Determinants of blood levels of some thrombogenic biomarkers in healthy Arab adolescent subjects

  • https://pubmed.ncbi.nlm.nih.gov/21663566/
  • Abayomi O Akanji, Abdulwahab N Al-Isa, Lukman Thalib (2011). Clinical chemistry and laboratory medicine. 2011 Jan 01
  • Abstract: Acute coronary syndromes present clinically as a consequence of plaque rupture and thrombosis possibly related to altered homeostasis of thrombogenic factors. It is speculated that this vuln…

Androidal Fat Dominates in Predicting Cardiometabolic Risk in Postmenopausal Women

  • https://pubmed.ncbi.nlm.nih.gov/21197412/
  • O A Matvienko, D L Alekel, ..., C D Perry (2011). Cardiology Research and Practice. 2011 Jan 01
  • ch enzyme-linked immunosorbent assay kit (ALPCO Diagnostics; Salem, NH) and plasma (heparinized) fibrinogen (mg/mL) concentration was determined with a sandwich enzyme-linked immunosorbent assay kit (AssayPro; St. Charles, MO) using a microtiter plate reader (ELx808; Bio-Tek Instruments, Inc., Winooski, VT). The intra-assay CVs for CRP and fibrinogen were 3.7% and 2.7%, respectively; the interassay

Plasma Clusterin Levels in Predicting the Occurrence of Coronary Artery Lesions in Patients With Kawasaki Disease

  • https://pubmed.ncbi.nlm.nih.gov/20711835/
  • Hong-Ren Yu, Ho-Chang Kuo, ..., Kuender D Yang (2010). Pediatric cardiology. 2010 Aug 15
  • Abstract: Kawasaki disease (KD) is the leading cause of acquired heart disease during childhood in the developed countries. Coronary artery lesions (CAL) are the major complications of KD. A unique pr…

Elevation of fasting insulin and its association with cardiovascular disease risk in women with systemic lupus erythematosus.

  • https://pubmed.ncbi.nlm.nih.gov/19037607/
  • Tim K Tso, Wen-Nan Huang (2009). Rheumatology international. 2009 Sep 02
  • In the study, the Human Fibrinogen FBG AssayMax ELISA Kit from Assaypro was utilized to measure plasma levels of fibrinogen, which was essential for evaluating fibrinolytic activity. T…

Amino acid-mediated heterotypic interaction governs performance of a hepatic tissue model

  • https://pubmed.ncbi.nlm.nih.gov/19246486/
  • Rohit Jindal, Yaakov Nahmias, ..., Martin L Yarmush (2009). The FASEB Journal. 2009 Jul 30
  • ribed previously (6) using a polyclonal antibody to rat albumin (Cappel Laboratories, Aurora, OH, USA). Fibrinogen concentration in the medium was evaluated using commercially available ELISA kit (Assaypro, St. Charles, MO, USA). Urea content was determined with a commercially available kit (StanBio Laboratory, Boerne, TX, USA). Standard curves were generated by dissolving different concentratio

An inhibitor of interleukin-6 trans-signalling, sgp130, contributes to impaired acute phase response in human chronic liver disease

  • https://pubmed.ncbi.nlm.nih.gov/19438606/
  • A Lemmers, T Gustot, ..., J Devière (2009). Clinical and experimental immunology. 2009 Jun 29
  • The enzyme-linked immunosorbent assay used to quantify IL-6, sIL-6R, sgp130 (Quantikine; R & D Systems, Abingdon, UK) and FBG (Assaypro, St Charles, MO, USA) had sensitivities of 3·12 pg/ml, 31·2 pg/ml, 0·125 ng/ml and 0·16 µg/ml respectively.

Trauma-hemorrhagic shock-induced red blood cell damage leads to decreased microcirculatory blood flow*

  • https://pubmed.ncbi.nlm.nih.gov/19237910/
  • George W. Machiedo, Sergey B. Zaets, ..., Edwin A. Deitch (2009). Critical Care Medicine. 2009 Mar 01
  • In the study, the Human Fibrinogen (FBG) AssayMax ELISA Kit from Assaypro was employed to measure fibrinogen levels, which was crucial for understanding the relationship between these …

A unique plasma proteomic profiling with imbalanced fibrinogen cascade in patients with Kawasaki disease.

  • https://pubmed.ncbi.nlm.nih.gov/19170925/
  • Hong-Ren Yu, Ho-Chang Kuo, ..., Kuender D Yang (2009). Pediatric allergy and immunology : officia…. 2009 Jan 12
  • In this study, the Human Fibrinogen (FBG) AssayMax ELISA Kit from Assaypro was instrumental in validating key protein level changes in plasma samples from patients with Kawasaki diseas…

Centrally located body fat is related to inflammatory markers in healthy postmenopausal women

  • https://pubmed.ncbi.nlm.nih.gov/18202591/
  • Courtney D Perry, D Lee Alekel, ..., Ulrike Genschel (2008). Menopause (New York, N.Y.). 2008 Jul 01
  • otiter plate reader (ELx808; Bio-Tek Instruments, Inc., Winooski, VT). Plasma (heparinized) fibrinogen concentration was determined in duplicate with a sandwich enzyme-linked immunosorbent assay kit (AssayPro; St. Charles, MO) using a microtiter plate reader (ELx808, Bio-Tek Instruments, Inc.). We used manufacturer-provided quality controls and in-house quality control sera/plasma for calculating i

In Vivo Efficacy of a New Autologous Fibrin Sealant

  • https://pubmed.ncbi.nlm.nih.gov/18279893/
  • Steven M. Alston, Kenneth A. Solen, ..., S. Fazal Mohammad (2008). Journal of Surgical Research. 2008 May 01
  • In the study, the Human Fibrinogen (FBG) AssayMax ELISA Kit from Assaypro was employed to measure fibrinogen concentrations in blood samples, which was essential for assessing the effi…

Early Coagulopathy After Traumatic Brain Injury: The Role of Hypoperfusion and the Protein C Pathway

  • https://pubmed.ncbi.nlm.nih.gov/18212647/
  • Mitchell Jay Cohen, Karim Brohi, ..., Jean-François Pittet (2007). Journal of Trauma: Injury, Infection Crit…. 2007 Dec 01
  • In the study, the Human Fibrinogen (FBG) AssayMax ELISA Kit from Assaypro was instrumental in analyzing plasma samples for key proteins related to coagulopathy in traumatic brain injur…

Technique for the control of spheroid diameter using microfabricated chips

  • https://pubmed.ncbi.nlm.nih.gov/17689307/
  • Yusuke Sakai, Kohji Nakazawa (2007). Acta Biomaterialia. 2007 Nov 01
  • Abstract: This paper describes a new technique for the control of spheroid diameter in liver-derived cell lines using microfabricated chips that were prepared by combining microfabrication with chemic…

Acute Traumatic Coagulopathy: Initiated by Hypoperfusion

  • https://pubmed.ncbi.nlm.nih.gov/17457176/
  • Karim Brohi, Mitchell J. Cohen, ..., Jean-Francois Pittet (2007). Annals of Surgery. 2007 May 01
  • In the study of acute traumatic coagulopathy, the Human Fibrinogen (FBG) AssayMax ELISA Kit from Assaypro was essential for analyzing fibrinogen levels in patients experiencing tissue …

New method to prepare autologous fibrin glue on demand

  • https://pubmed.ncbi.nlm.nih.gov/17383592/
  • Steven M. Alston, Kenneth A. Solen, ..., S. Fazal Mohammad (2007). Translational Research. 2007 Apr 01
  • The study explored a novel method for preparing autologous fibrin sealants directly from human plasma, significantly addressing safety concerns linked to blood-borne infections. This a…

Differentiation Effects by the Combination of Spheroid Formation and Sodium Butyrate Treatment in Human Hepatoblastoma Cell Line (Hep G2): A Possible Cell Source for Hybrid Artificial Liver

  • https://pubmed.ncbi.nlm.nih.gov/16454356/
  • J. Fukuda, K. Okamura, ..., K. Funatsu (2005). Cell Transplantation. 2005 Nov 01
  • Abstract: The aim of this study was to investigate the feasibility of human hepatoblastoma cell line (Hep G2), which differentiates by spheroid formation, and treatment with sodium butyrate (SB) as a …

Efficacy of a Polyurethane Foam/Spheroid Artificial Liver by Using Human Hepatoblastoma Cell Line (Hep G2)

  • https://pubmed.ncbi.nlm.nih.gov/12693664/
  • J. Fukuda, K. Okamura, ..., K. Funatsu (2003). Cell Transplantation. 2003 Jan 01
  • In the study examining the efficacy of Hep G2 cell spheroids within polyurethane foam, the Human Fibrinogen (FBG) AssayMax ELISA Kit from Assaypro played a crucial role in measuring th…

Loading data...